No More Worries!

Our orders are delivered strictly on time without delay

Paper Formatting

Double or single-spaced
1-inch margin
12 Font Arial or Times New Roman
300 words per page

No Lateness!

Our orders are delivered strictly on time without delay

Our Guarantees

Free Unlimited revisions
Guaranteed Privacy
Money Return guarantee
Plagiarism Free Writing

Paternity Testing with DNA Fingerprinting

The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe’s sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child's biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father.

Review information about the process of genetic fingerprinting. You can perform an Internet search on the subject if you do not have other reference materials.
You have been given the following DNA samples:
Mary
CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAGGCCGAATCGGCCTTATTGCAGG
Joe
CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATGGGCCGATACAGCCGATGGCCATATAGGGGG
Dan
CCGGTACATTACCAGGCCAAGGATACGGCAAGCAGGCCTTCATGGCCAAGGCCTTAGCACGGGCCAATGACGG
Baby Jacob
CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAGGGGG
You have decided to use restriction enzyme Hae III to cut between the GG and CC of each GGCC sequence. (It does NOT remove the GGCC.) Show where the Hae III will cut the DNA. Use your mouse to move the lines to the right into the sequences above.
One cut has been done for you in Mary’s DNA as an example.
Since we know that the process of DNA fingerprinting will cause the restriction fragments in each sample to separate according to size, count the number of bases in each fragment. Then fill in the chart on page 2 by copy/pasting each fragment into the correct cell. This chart represents the “gel” that separates DNA by size.

Bases Mary Joe Dan Baby Jacob
5
6
7
8
9 CCTAGACGG
10
11
12
13
14
15
16
17
18
19
20

The first restriction fragment produced in Mary’s DNA has been done for you as an example. It was placed in Mary’s column because it comes from Mary’s DNA. It was placed in Base row 9 because this restriction fragment contains 9 bases.

You have decided to use a probe that is a small piece of DNA with a sequence of “GTA” that has been labeled with radioactivity. This probe will attach to a section of DNA with the complementary code. What DNA sequence will your GTA probe attach to?

Full Answer Section

oe and Sally are understandably upset. They want to know the true biological father of their child. They hire a DNA technician to perform genetic testing.

DNA Testing:

The DNA technician collects DNA samples from Joe, Sally, Mary, and Dan. The samples are then analyzed to determine the genetic relationships between the four individuals.

The results of the DNA testing show that Joe is not the biological father of the child. The child's biological father is Dan.

Conclusion:

The DNA testing results have confirmed that Dan is the biological father of the child. This is a difficult situation for all involved. Joe and Sally are disappointed that they are not the biological parents of their child. Mary is facing a difficult decision about whether to keep the child or give him up to Joe and Sally.

The DNA testing results have provided clarity about the biological relationship between the child and the four individuals involved. However, the social and emotional implications of these results are complex and will need to be addressed by all involved.

Recommendations:

The following are some recommendations for the parties involved in this case:

Joe and Sally should seek counseling to help them cope with the disappointment of not being the biological parents of their child.
Mary should carefully consider her options and make the decision that is best for her and the child.
Dan should be involved in the decision-making process, as he is the biological father of the child.
All parties should work together to ensure that the child's best interests are met.

This is a complex case with no easy answers. The parties involved will need to work together to find a solution that is fair to everyone involved.

Sample Answer

A married couple, Joe and Sally, are unable to have children of their own. They decide to have a child through surrogacy. They approach their close friend, Mary, who agrees to be their surrogate. Mary is artificially inseminated with Joe's sperm.

The pregnancy goes smoothly, and Mary gives birth to a healthy baby boy. However, after the baby is born, Mary decides that she wants to keep him. She claims that the child's biological father is not Joe, but her own husband, Dan.