Five perspectives on genomics

1. In UCSC Genome Browser, you will create/visualize a new custom track of all the 3’UTR genome-wide in “mm10” RefSeq Genes annotation. Take screenshots for each major step. (20 points)
2. What is the sequence shown in the following gel? Find out where this DNA came from. Take screenshots (20 pts)
3. The genomes of the following organisms were sequenced: human, loblolly pine (Pinus taeda), mouse, chicken, pufferfish (Takifugu rubripes), D. melanogaster, C. elegans, Saccharomyces cerevisiae, Arabidopsis thaliana, E. coli. Rank the genomes by size. (5 pts)
4. What are the five perspectives on genomics? (5 pts)
5. Phylogenetic analysis using MEGA7. Using Dr. Tusbota’s data (Tsubota_ER_all_16_seqs_fasta.txt) to build phylogenetic trees. You can use any tool within MEGA7 to align the sequences and any method to create a tree. Take screenshots of your critical steps and results. (15 points)
6. Compare two following protein sequences using their accession numbers for "NP_000954" and "NP_000953". Make sure NP_000954 will be the Query, and NP_000953, the Subject. (10 points)
   a. What is the overall amino acid identity? Report which range of the region is aligned. Take screenshots for Graphic Summary, Dot Matrix View and Alignments to show your results.
   b. Notice that a separate percentage is calculated for similarities (called "Positives"), which takes into account the similar structures of some amino acids. What is the percent similarity?
7. (5 points) What are the molecules used to build the tree of life? Why?
8. (5 points) What’s the Baltimore virus classification? What are those classes and their corresponding characteristics? Which class does coronavirus belong to?
9. Here is a sequence of DNA. The following questions will be based on this DNA sequence. You need to explicitly answer the questions including which tools and/or databases you use, and take screenshots to support your answers as evidence. Be as accurate as you can be. [Note that you need to write down your answers, just pasting screenshots is not enough. Also make sure your screenshots are legible.]

ACTTCATTCCTGGGCTTCACCCCATTCTGAGTTTGTCCAAGATGGACCAG
ACTCTGGCAGTCTATCAACAGGTCCTCACCAGCCTGCCTTCCCAAAATGT
GCTGCAGATAGCCAATGACCTGGAGAATCTCCGAGACCTCCTCCATCTGC
TGGCCTTCTCCAAGAGCTGCTCCCTGCCTCAGACCAGTGGCCTGCAGAAG
CCAGAGAGCCTGGATGGCGTCCTGGAAGCCTCACTCTACTCCACAGAGGT
GGTGGCTTTGAGCAGGCTGCAGGGCTCTCTGCAGGACATTCTTCAACAGT
TGGATGTTAGCCCTGAATGCTGAAGTTTCAAAGGCCACCAGGCTCCCAAG
AATCATGTAGAGGGAAGAAACCTTGGCTTCCAGGGGTCTTCAGGAGAAGA
GAGCCATGTGCACACATCCATCATTCATTTCTCTCCCTCCTGTAGACCAC
CCATCCAAAGGCATGACTCCACAATGCTTGACTCAAGTTATCCACACAAC
TTCATGAGCACAAGGAGGGGCCAGCCTGCAGAGGGGACTCTCACCTAGTT
CTTCAGCAAGTAGAGATAAGAGCCATCCCATCCCCTCCATGTCCCACCTG

a. (10 points) Which gene and species did this DNA sequence come from? Take screenshots of critical steps to show your work. Hint: you may choose the RefSeq Gene.

b. (5 points) Which chromosome does this gene locate? How many exons does it have? What’s the official symbol of this gene? Take screenshots to show your work.

c. (10 points) Visualize this gene in UCSC Genome Browser. Describe if there are repetitive DNA elements within the locus of this gene. Also, describe if this gene is conserved among the vertebrates. Make sure to include the “RefSeq Genes” track. Take screenshots to show your work.

10. ESSAY: Pick ONE(1) of the following questions to answer in Essay format. Be as thorough as possible but limit the length to one page, double-spaced, font size 12. (15 points)

i) How do you think about GMOs (Genetically Modified Organism)? Discuss the benefits and ethical issues of GMOs in your own opinions. What’s the potential risk to human health, ecological systems on earth?
or
ii) Why are the regulatory elements in the genome are so important?