Assignment 10 - Converting your name into a protein

Assignment 10 - Converting your name into a protein This assignment is worth 15 points. It does not require that you purchase any materials. Important note: Do not attempt this activity until after you have completed the lessons on transcription, translation, and the genetic code (Lessons 10C-10E). They provide the necessary background. Learning outcomes • Be able to transcribe a given DNA sequence into mRNA, and translate the mRNA codons into amino acids. • Identify the start and stop codons in the mRNA sequence. Introduction In this activity, you will create a DNA strand from a set of names, transcribe it into a complementary strand of mRNA, and then translate it into a chain of amino acids (e.g. a protein). It will be very similar to the transcription and translation practice that you did in your lessons, except this time you will use a real genetic code chart to determine the actual amino acids. Step 1: Decide on the names Use your own first and last names, followed by the first and last names of two celebrities (e.g. actors, actresses, musicians, politicians, etc.) of your choice. Do not use a celebrity who goes by a single name (e.g. "Madonna"). In other words, your two celebrities must have both first and last names. Following the example below, write down the names of the three people, starting with yourself, in a computer document. You will be submitting your document in the assignment dropbox when it is complete. Example: • Iamyour Instructor + Charles Darwin + Gregor Mendel Step 2: Add "Hey" Add "Hey" to the beginning your series of names. Put your updated sequence of names into your computer document. Example: • Hey + Iamyour Instructor + Charles Darwin + Gregor Mendel Step 3: Make a single chain of letters Next, combine all of your words and take away the spaces. Add your single chain of letters to your computer document. Example: • HeyIamyourInstructorCharlesDarwinGregorMendel Step 4: Turn your chain of letters into a DNA strand Using the following criteria, turn all of your letters into DNA nitrogenous bases (A, T, G, or C). It does not matter whether the letters of your names are upper case or lower case. Use uppercase letters to indicate the DNA bases, though. • if a letter in the Name is A, B, C, D, E, or F, it becomes A in the DNA. • if a letter in the Name is G, H, I, J, K, or L, it becomes T in the DNA. • if a letter in the Name is M, N, O, P, Q, or R, it becomes G in the DNA. • if a letter in the Name is S, T, U, V, W, X, Y, or Z, it becomes C in the DNA. Example: • Name: HeyIamyourInstructor • DNA: TACTAGCGCGTGCCGCACGG In the example, I have only shown how to turn the first section, "HeyIamyourInstructor," into DNA. For "Hey," the "H" becomes "T" (DNA), the "e" becomes "A" (DNA), the "y" becomes "C" (DNA), and so on. Using the same methodology, turn your entire chain of letters into a DNA sequence. Add your DNA sequence to your computer document. Step 5: Create 3 letter segments Working left to right, separate your DNA strand into 3 letter segments. This will make it easier to complete the rest of the activity. Don't be concerned about the fact that your last segment may have less than three letters. The same thing can happen in real DNA. Example: • DNA: TAC TAG CGC GTG CCG CAC GG In the example, I have only shown how to create segments for the first section of my DNA. Using the same methodology, create segments for your entire DNA sequence. Add your segmented DNA to your computer document. Step 6: Transcribe your DNA into mRNA Recall from your lessons that DNA has 4 different nitrogenous bases: Adenine (A), Thymine (T), Guanine (G), and Cytosine (C). mRNA has the same bases, except that it does not contain any Thymine (T). Instead of Thymine, mRNA has Uracil (U). Thus, mRNA has Adenine (A), Uracil (U), Guanine (G), and Cytosine (C). Thus, when transcribing DNA into mRNA: • A (DNA) becomes U (mRNA) • T (DNA) becomes A (mRNA) • C (DNA) becomes G (mRNA) • G (DNA) becomes C (mRNA) Example: • DNA: TAC TAG CGC GTG CCG CAC GG • mRNA: AUG AUC GCG CAC GGC GUG CC In the example, I have only shown how to transcribe the first section of my DNA sequence into mRNA. The "T" (DNA) becomes "A" (mRNA), the "A" (DNA) becomes "U" (mRNA), the "C" (DNA) becomes "G" (mRNA), and so on. Using the same methodology, transcribe your entire chain of letters into a mRNA sequence. Add your mRNA sequence to your computer document. Step 7: Translate your mRNA into amino acids Using a real genetic code chart (figure A10-1) or the alternate version (not a table), determine the corresponding amino acid for each three letter mRNA codon. If your last codon has less than three letters, then it does not code for an amino acid. If that happens, just leave it blank. Figure A10-1: This figure shows a table including the genetic code for translating each nucleotide triplet, or codon, in mRNA into an amino acid or a termination signal. All 64 codons are shown. Sixty-two of these code for amino acids, and three are stop codons shown in red. The start codon, AUG, is colored green. (credit: modification of work by NIH) If you have trouble viewing the table format of the genetic code, click on the following link for an alternate version: • The genetic code in an alternate format (not a table) You will notice that there is redundancy in the genetic code. For example, the mRNA codons UCU, UCC, UCA, UCG, AGU, and AGC all code for "Ser," which is the abbreviation for the amino acid Serine. For your answers, please just write the three letter amino acid abbreviations (e.g. Ser) specified by each codon. If you find that one or more of your codons specify "stop" instead of an amino acid, go ahead and write "stop" in place of an actual amino acid, but continue to translate the rest of your mRNA codons as though you had not hit the stopping point. I want to see your entire mRNA sequence translated. Example: • mRNA codons: AUG AUC GCG CAC GGC GUG CC • The Amino Acids: Met - Ile - Ala - His - Gly - Val In the example, I have only shown how to translate the first section of my mRNA codons. The AUG (mRNA) translates into Met (Amino Acid), AUC (mRNA) translates into Ile (Amino Acid), GCG (mRNA) translates into Ala (Amino Acid), CAC (mRNA) translates into His (Amino Acid), GGC (mRNA) translates into Gly (Amino Acid), and GUG (mRNA) translates into Val (Amino Acid). Note that CC (mRNA) does not code for any amino acid, so it is left blank. The dashes (-) between the amino acids stand for peptide bonds, which link the amino acids to one another. You can leave out the dashes, if you wish. Using the same methodology, translate all of your mRNA codons into an amino acid chain. If you hit a stop codon, don't stop! Just write "stop" and continue to translate the rest of your mRNA sequence. Add your amino acid chain to your computer document. End of activity questions 1. Which mRNA codon is the "start" codon (in other words, what is its three letter code)? 2. Which amino acid is coded for by the "start" codon? (please give both its 3 letter amino acid abbreviation and its full name) 3. Which three mRNA codons are the "stop" codons (in other words, what are their three letter codes)? 4. How many stop codons, if any, did you encounter in your sequence of mRNA codons? A final note: When DNA in your body is transcribed into mRNA, and then translated into amino acids, all mRNA codons encountered after the first stop codon are ignored. In other words, they do not translate into amino acids, and thus do not add to the length of the actual amino acid chain. The reason that I had you continue to translate, even after encountering a stop codon, is that I wanted you to get additional practice using the genetic code chart. Your evaluation of the activity 1. Did the activity help you understand the concept of transcription and translation? 2. Are the directions for the activity clear? 3. What part of the activity was confusing? 4. Include any suggestions you have to improve this activity. Thanks for your input. Congratulations! You are now done with this activity. In order to receive your points, be sure to submit your document containing your assignment answers, including all steps, your answers to the end of the activity questions (#1-4), and your evaluation of the activity, in the Assignment 10 dropbox. Grading criteria